Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTGATACTTGCCCAGTCACTTAGT[C/T]AAGAAAATTGTGTACTTCAGGCAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608667 | ||||||||||||||||||||
Literature Links: |
NIPBL PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NIPBL - NIPBL, cohesin loading factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015384.4 | Intron | NP_056199.2 | ||||
NM_133433.3 | Intron | NP_597677.2 | ||||
XM_005248280.3 | Intron | XP_005248337.1 | ||||
XM_005248282.4 | Intron | XP_005248339.3 | ||||
XM_006714467.2 | Intron | XP_006714530.1 | ||||
XM_006714468.2 | Intron | XP_006714531.1 | ||||
XM_011514015.1 | Intron | XP_011512317.1 | ||||
XM_017009329.1 | Intron | XP_016864818.1 | ||||
XM_017009330.1 | Intron | XP_016864819.1 | ||||
XM_017009331.1 | Intron | XP_016864820.1 |
NIPBL-AS1 - NIPBL antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |