Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTTCCTAAAGCACAGCTCGGTGG[A/G]AACAAACAGCTATGGACATACAGAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612333 MIM: 601787 MIM: 615204 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR1307 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR1307 - microRNA 1307 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDCD11 - programmed cell death 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014976.1 | 115 | Intron | NP_055791.1 | |||
XM_005269647.3 | 115 | Intron | XP_005269704.1 | |||
XM_011539538.2 | 115 | Intron | XP_011537840.1 | |||
XM_011539539.2 | 115 | Intron | XP_011537841.1 | |||
XM_011539540.1 | 115 | Intron | XP_011537842.1 |
TAF5 - TATA-box binding protein associated factor 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USMG5 - up-regulated during skeletal muscle growth 5 homolog (mouse) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001206426.1 | 115 | Intron | NP_001193355.1 | |||
NM_001206427.1 | 115 | UTR 5 | NP_001193356.1 | |||
NM_032747.3 | 115 | Intron | NP_116136.1 |