Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATGGCACGAGCAGCGTTCTCTGAG[G/T]ATGGGGCCCTGATGGATGGTGGCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606881 | ||||||||||||||||||||
Literature Links: |
FHOD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FHOD1 - formin homology 2 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318202.1 | 467 | Intron | NP_001305131.1 | |||
NM_013241.2 | 467 | Intron | NP_037373.2 | |||
XM_006721180.1 | 467 | Intron | XP_006721243.1 | |||
XM_011523043.2 | 467 | Intron | XP_011521345.1 | |||
XM_011523044.1 | 467 | Intron | XP_011521346.1 | |||
XM_011523045.2 | 467 | Intron | XP_011521347.1 |
LOC105369155 - uncharacterized LOC105369155 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC29 - leucine rich repeat containing 29 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM208 - transmembrane protein 208 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318217.1 | 467 | Missense Mutation | GAT,TAT | D,Y 12 | NP_001305146.1 | |
NM_014187.3 | 467 | Missense Mutation | GAT,TAT | D,Y 82 | NP_054906.2 |