Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGCATGGGGATCCGGGAGAAGCAC[C/T]CACAAAACTAGCATCCTCCTGGAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
C17orf80 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C17orf80 - chromosome 17 open reading frame 80 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001100621.2 | 96 | UTR 5 | NP_001094091.1 | |||
NM_001100622.2 | 96 | UTR 5 | NP_001094092.1 | |||
NM_001288770.1 | 96 | UTR 5 | NP_001275699.1 | |||
NM_001288771.1 | 96 | UTR 5 | NP_001275700.1 | |||
NM_017941.5 | 96 | UTR 5 | NP_060411.2 | |||
XM_005257487.3 | 96 | UTR 5 | XP_005257544.1 | |||
XM_006721966.3 | 96 | UTR 5 | XP_006722029.1 | |||
XM_011524961.1 | 96 | UTR 5 | XP_011523263.1 | |||
XM_011524962.2 | 96 | Intron | XP_011523264.1 | |||
XM_017024806.1 | 96 | UTR 5 | XP_016880295.1 |
CPSF4L - cleavage and polyadenylation specific factor 4 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM104A - family with sequence similarity 104 member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001098832.1 | 96 | Intron | NP_001092302.1 | |||
NM_001289410.1 | 96 | Intron | NP_001276339.1 | |||
NM_001289411.1 | 96 | Intron | NP_001276340.1 | |||
NM_001289412.1 | 96 | Intron | NP_001276341.1 | |||
NM_032837.2 | 96 | Intron | NP_116226.2 |