Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACATTTGTAAAAGTAGGACAGCAA[A/G]GTTTCACTGTAGCCCACGAGGAAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611986 MIM: 610337 | ||||||||||||||||||||
Literature Links: |
MRPS24 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MRPS24 - mitochondrial ribosomal protein S24 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032014.2 | 474 | Silent Mutation | ACC,ACT | T,T 141 | NP_114403.1 |
URGCP - upregulator of cell proliferation | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
URGCP-MRPS24 - URGCP-MRPS24 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204871.1 | 474 | UTR 3 | NP_001191800.1 |