Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGTAGAACAGATATCCCTGGTAAA[A/G]GTAGAATTTCTCATTTTTCACAGCT
Species: |
Human | |||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||
Phenotype: |
MIM: 615231 MIM: 605976 | |||||||||||||||||||||||||||||
Literature Links: |
RC3H2 PubMed Links | |||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
RC3H2 - ring finger and CCCH-type domains 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB26 - zinc finger and BTB domain containing 26 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB6 - zinc finger and BTB domain containing 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006626.5 | 2113 | UTR 3 | NP_006617.1 |
Set Membership: |
HapMap |