Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTTTGACGGTGGTAGTAGCATTCC[G/T]GGAGCTGGTGGAGCCAAGGAAACAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 134629 | ||||||||||||||||||||
Literature Links: |
FDPS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FDPS - farnesyl diphosphate synthase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001135821.1 | 623 | Missense Mutation | CGG,CTG | R,L 135 | NP_001129293.1 | |
NM_001135822.1 | 623 | Intron | NP_001129294.1 | |||
NM_001242824.1 | 623 | Intron | NP_001229753.1 | |||
NM_001242825.1 | 623 | Intron | NP_001229754.1 | |||
NM_002004.3 | 623 | Missense Mutation | CGG,CTG | R,L 135 | NP_001995.1 | |
XM_005244962.1 | 623 | Intron | XP_005245019.1 | |||
XM_005244963.1 | 623 | Intron | XP_005245020.1 |
LOC105371451 - uncharacterized LOC105371451 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RUSC1 - RUN and SH3 domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RUSC1-AS1 - RUSC1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |