Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGTGCTCATCGACAGCACACCGTAC[C/G]GACAGTGGTACGAGTCCCACTATGC
Species: |
Human | ||||||||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||||||||
Phenotype: |
MIM: 607336 MIM: 604538 MIM: 600357 | ||||||||||||||||||||||||||
Literature Links: |
BEST4 PubMed Links | ||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
BEST4 - bestrophin 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KIF2C - kinesin family member 2C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS8 - ribosomal protein S8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012.1 | Intron | NP_001003.1 |
SNORD38A - small nucleolar RNA, C/D box 38A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD38B - small nucleolar RNA, C/D box 38B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD46 - small nucleolar RNA, C/D box 46 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD55 - small nucleolar RNA, C/D box 55 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |