Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAATAAGAGAAAATATAGGAAAATA[G/T]GACCAAAGGGTGGGGGAAGACCTTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603882 MIM: 606144 | ||||||||||||||||||||
Literature Links: |
BAG2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BAG2 - BCL2 associated athanogene 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004282.3 | Intron | NP_004273.1 | ||||
XM_005249490.3 | Intron | XP_005249547.1 | ||||
XM_011514998.2 | Intron | XP_011513300.1 | ||||
XM_011514999.2 | Intron | XP_011513301.1 |
LOC101927211 - uncharacterized LOC101927211 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB23 - RAB23, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |