Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTTAATGAAGGATCCAATTATTAA[A/G]GGCCAGTGAAACCATAAAATCTTAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604764 | ||||||||||||||||||||
Literature Links: |
C8orf76 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C8orf76 - chromosome 8 open reading frame 76 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZHX1 - zinc fingers and homeoboxes 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001017926.2 | 3951 | UTR 3 | NP_001017926.1 | |||
NM_007222.4 | 3951 | UTR 3 | NP_009153.3 |
ZHX1-C8orf76 - ZHX1-C8orf76 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204180.1 | 3951 | Intron | NP_001191109.1 |