Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGAATCAAAGGCAGCCAAGGAGA[G/T]GCCCAAGCAGGAGGTGACCAAAGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604303 MIM: 604304 MIM: 603722 | ||||||||||||||||||||
Literature Links: |
ACTL7A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACTL7A - actin like 7A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006687.3 | 283 | Missense Mutation | AGG,ATG | R,M 63 | NP_006678.1 |
ACTL7B - actin like 7B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IKBKAP - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |