Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCATGCAGAGCCCTGAGGCTGGGCA[G/T]GCAGGGAGCTCTGCCTGCACAATGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607764 MIM: 611052 MIM: 601485 | ||||||||||||||||||||
Literature Links: |
HSD3B7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HSD3B7 - hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SETD1A - SET domain containing 1A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STX1B - syntaxin 1B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_052874.4 | 2564 | UTR 3 | NP_443106.1 | |||
XM_017022893.1 | 2564 | UTR 3 | XP_016878382.1 |