Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTATCCAGGAAGCTTACCAGCTGCT[A/G]CTGACCGACCACACTGTGACCTTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612185 MIM: 608755 | ||||||||||||||||||||
Literature Links: |
CASKIN2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CASKIN2 - CASK interacting protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LLGL2 - LLGL2, scribble cell polarity complex component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSEN54 - tRNA splicing endonuclease subunit 54 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_207346.2 | 464 | Silent Mutation | CTA,CTG | L,L 144 | NP_997229.2 | |
XM_005257229.3 | 464 | Silent Mutation | CTA,CTG | L,L 144 | XP_005257286.1 |