Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGAAGACAGGCCGAGTGATGCTTG[G/T]GGAGACCAATCCAGCAGATTCAAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 156490 MIM: 156491 | ||||||||||||||||||||
Literature Links: |
MBTD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MBTD1 - mbt domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NME1 - NME/NM23 nucleoside diphosphate kinase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NME1-NME2 - NME1-NME2 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018136.2 | 505 | Missense Mutation | GGG,GTG | G,V 207 | NP_001018146.1 |
NME2 - NME/NM23 nucleoside diphosphate kinase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018137.2 | 505 | Missense Mutation | GGG,GTG | G,V 92 | NP_001018147.1 | |
NM_001018138.1 | 505 | Intron | NP_001018148.1 | |||
NM_001018139.2 | 505 | Intron | NP_001018149.1 | |||
NM_001198682.1 | 505 | Intron | NP_001185611.1 | |||
NM_002512.3 | 505 | Missense Mutation | GGG,GTG | G,V 92 | NP_002503.1 |