Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCATCAGTTATGGTCCCCACAACCA[C/T]GGCCGTCTTGTTTTCCCGGCCAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604179 MIM: 609932 MIM: 607092 | ||||||||||||||||||||
Literature Links: |
FAM83E PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM83E - family with sequence similarity 83 member E | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL18 - ribosomal protein L18 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000979.3 | 516 | Missense Mutation | ATG,GTG | M,V 81 | NP_000970.1 | |
NM_001270490.1 | 516 | Missense Mutation | ATG,GTG | M,V 52 | NP_001257419.1 |
SPACA4 - sperm acrosome associated 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPHK2 - sphingosine kinase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |