Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGAGAAACTGGCAAGGAGAAGCTC[A/C]CGCGGTACTACAAGAACATCGGTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611114 MIM: 180471 | ||||||||||||||||||||
Literature Links: |
MIR150 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR150 - microRNA 150 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL13A - ribosomal protein L13a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS11 - ribosomal protein S11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001015.4 | Intron | NP_001006.1 |
SNORD32A - small nucleolar RNA, C/D box 32A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD33 - small nucleolar RNA, C/D box 33 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD34 - small nucleolar RNA, C/D box 34 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD35A - small nucleolar RNA, C/D box 35A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD35B - small nucleolar RNA, C/D box 35B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |