Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGGCGTCCGGGCGCCGAAAGTCCG[A/G]GCAACGGGGCCGAGGCGCGGCGCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610695 MIM: 607632 | ||||||||||||||||||||
Literature Links: |
HSPB6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HSPB6 - heat shock protein family B (small) member 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144617.2 | 80 | Missense Mutation | CCC,CTC | P,L 20 | NP_653218.1 |
LIN37 - lin-37 DREAM MuvB core complex component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PROSER3 - proline and serine rich 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSENEN - presenilin enhancer gamma-secretase subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |