Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATAGCCACTGCTTCGCCAGAGAGAA[A/G]GAAGGGGATAAACCCAGCGCCACCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608743 MIM: 601579 | ||||||||||||||||||||
Literature Links: |
C19orf35 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C19orf35 - chromosome 19 open reading frame 35 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
JSRP1 - junctional sarcoplasmic reticulum protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OAZ1 - ornithine decarboxylase antizyme 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001301020.1 | 170 | Silent Mutation | AAA,AAG | K,K 19 | NP_001287949.1 | |
NM_004152.3 | 170 | Silent Mutation | AAA,AAG | K,K 19 | NP_004143.1 |