Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGCATTGTTAGCTCTGCTCAGCGT[C/T]CAGCCAGAGACCTGGGACTCCCCCA
Species: |
Human | |||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||
Phenotype: |
MIM: 602434 MIM: 606441 MIM: 607163 | |||||||||||||||||||||||||||||
Literature Links: |
AUP1 PubMed Links | |||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
AUP1 - ancient ubiquitous protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DQX1 - DEAQ-box RNA dependent ATPase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HTRA2 - HtrA serine peptidase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321727.1 | 1443 | Missense Mutation | CCA,TCA | P,S 281 | NP_001308656.1 | |
NM_001321728.1 | 1443 | Missense Mutation | CCA,TCA | P,S 281 | NP_001308657.1 | |
NM_013247.4 | 1443 | Missense Mutation | CCA,TCA | P,S 281 | NP_037379.1 | |
NM_145074.2 | 1443 | Intron | NP_659540.1 |
LOXL3 - lysyl oxidase like 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |