Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCGCGCTGTTCCAGCAGCTGGCGC[C/T]GCGTGTGGTGCAGCAGCTGGGTCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
BREA2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BREA2 - breast cancer estrogen-induced apoptosis 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CCDC166 - coiled-coil domain containing 166 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001162914.1 | 734 | Missense Mutation | CAG,CGG | Q,R 245 | NP_001156386.1 |
LOC101928160 - uncharacterized LOC101928160 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAPK15 - mitogen-activated protein kinase 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |