Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCGAGGATGCCACAGTGCAGTCGG[A/G]TATGAAACACTGGCCGTTCCGGGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 140560 MIM: 616578 | ||||||||||||||||||||
Literature Links: |
HSPA2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HSPA2 - heat shock protein family A (Hsp70) member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021979.3 | 642 | Missense Mutation | GAT,GGT | D,G 87 | NP_068814.2 |
LOC102723809 - uncharacterized LOC102723809 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP1R36 - protein phosphatase 1 regulatory subunit 36 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB1 - zinc finger and BTB domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |