Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGCAGGTAGTGCAACAGTGACCCA[A/G]AGGTCTGGGCATCCTGTGGTGGGAG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 606371 MIM: 600447 MIM: 604643 MIM: 605053 | |||||||||||||||||||||||
Literature Links: |
ATF7 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ATF7 - activating transcription factor 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130060.1 | 540 | Intron | NP_001123532.1 | |||
NM_001206682.1 | 540 | Intron | NP_001193611.1 | |||
NM_001206683.1 | 540 | Intron | NP_001193612.1 | |||
NM_006856.2 | 540 | Intron | NP_006847.1 | |||
XM_005268587.3 | 540 | Intron | XP_005268644.1 | |||
XM_017018722.1 | 540 | Intron | XP_016874211.1 |
LOC100652999 - uncharacterized LOC100652999 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAP3K12 - mitogen-activated protein kinase kinase kinase 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NPFF - neuropeptide FF-amide peptide precursor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320296.1 | 540 | Missense Mutation | TCT,TTT | S,F 52 | NP_001307225.1 | |
NM_003717.3 | 540 | Missense Mutation | TCT,TTT | S,F 49 | NP_003708.1 |
TARBP2 - TARBP2, RISC loading complex RNA binding subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004178.4 | 540 | Intron | NP_004169.3 | |||
NM_134323.1 | 540 | Intron | NP_599150.1 | |||
NM_134324.2 | 540 | Intron | NP_599151.2 | |||
XM_005269114.1 | 540 | Intron | XP_005269171.1 | |||
XM_005269115.2 | 540 | Intron | XP_005269172.1 | |||
XM_005269117.1 | 540 | Intron | XP_005269174.1 | |||
XM_005269120.4 | 540 | Intron | XP_005269177.1 | |||
XM_005269122.3 | 540 | Intron | XP_005269179.1 | |||
XM_006719581.1 | 540 | Intron | XP_006719644.1 | |||
XM_011538712.2 | 540 | Intron | XP_011537014.1 | |||
XM_017019910.1 | 540 | Intron | XP_016875399.1 | |||
XM_017019911.1 | 540 | Intron | XP_016875400.1 |
Set Membership: |
HapMap |