Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAATTTTCTCTTGCACACAGCTTGC[A/T]CTTCTGGACCATGGAAGCACTGCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 600650 MIM: 602603 | ||||||||||||||||||||
Literature Links: |
C1orf123 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C1orf123 - chromosome 1 open reading frame 123 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304759.1 | 206 | Missense Mutation | AGC,TGC | S,C 48 | NP_001291688.1 | |
NM_001304760.1 | 206 | Missense Mutation | AGC,TGC | S,C 20 | NP_001291689.1 | |
NM_017887.2 | 206 | Missense Mutation | AGC,TGC | S,C 67 | NP_060357.1 |
CPT2 - carnitine palmitoyltransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAGOH - mago homolog, exon junction complex core component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |