Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAATTGCATTACTTTACAAACTCAT[A/T]GTACTCTGTTTGGCCATTAGTCTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612275 MIM: 610275 | ||||||||||||||||||||
Literature Links: |
GGNBP2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GGNBP2 - gametogenetin binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYO19 - myosin XIX | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIGW - phosphatidylinositol glycan anchor biosynthesis class W | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_178517.3 | 907 | Nonsense Mutation | TAG,TTG | *,L 203 | NP_848612.2 | |
XM_005257238.2 | 907 | Nonsense Mutation | TAG,TTG | *,L 203 | XP_005257295.1 | |
XM_011524646.2 | 907 | Nonsense Mutation | TAG,TTG | *,L 203 | XP_011522948.1 |