Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCACTCTGATGCTGAACACCCCC[C/T]TCCCCCACCTCTTCCCCAATATCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 604590 | ||||||||||||||||||||
Literature Links: |
FCGR2B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FCGR2B - Fc fragment of IgG receptor IIb | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002273.2 | Intron | NP_001002273.1 | ||||
NM_001002274.2 | Intron | NP_001002274.1 | ||||
NM_001002275.2 | Intron | NP_001002275.1 | ||||
NM_001190828.1 | Intron | NP_001177757.1 | ||||
NM_004001.4 | Intron | NP_003992.3 | ||||
XM_011509292.2 | Intron | XP_011507594.1 | ||||
XM_017000669.1 | Intron | XP_016856158.1 | ||||
XM_017000670.1 | Intron | XP_016856159.1 | ||||
XM_017000671.1 | Intron | XP_016856160.1 | ||||
XM_017000672.1 | Intron | XP_016856161.1 |
RPL31P11 - ribosomal protein L31 pseudogene 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |