Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCCTGTGCACTTTAATTTTCTGTG[C/T]AATTTTGTTGTGCTTTGCATTTTAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
LOC100289361 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100289361 - uncharacterized LOC100289361 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAQR9-AS1 - PAQR9 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
U2SURP - U2 snRNP associated SURP domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080415.1 | Intron | NP_001073884.1 | ||||
NM_001320219.1 | Intron | NP_001307148.1 | ||||
NM_001320220.1 | Intron | NP_001307149.1 | ||||
NM_001320222.1 | Intron | NP_001307151.1 | ||||
XM_005247248.4 | Intron | XP_005247305.1 | ||||
XM_017006037.1 | Intron | XP_016861526.1 | ||||
XM_017006038.1 | Intron | XP_016861527.1 | ||||
XM_017006039.1 | Intron | XP_016861528.1 |