Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTCCTCTCAGTGTCCTCGGACCC[A/C]GCTTGGGCTGTGGAGTGGATCGAAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600570 MIM: 600495 | ||||||||||||||||||||
Literature Links: |
CLCN2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CLCN2 - chloride voltage-gated channel 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EIF4G1 - eukaryotic translation initiation factor 4 gamma 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM131A - family with sequence similarity 131 member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001171093.1 | 245 | Intron | NP_001164564.1 | |||
NM_144635.4 | 245 | Silent Mutation | CCA,CCC | P,P 34 | NP_653236.3 | |
XM_005247113.2 | 245 | UTR 5 | XP_005247170.1 | |||
XM_005247114.3 | 245 | Intron | XP_005247171.1 | |||
XM_011512413.2 | 245 | Intron | XP_011510715.1 |