Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGTAAACTTCAAGAAGGAGGGCA[A/G]GAGCCCCACCCTACAGGGCTGGGAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603382 MIM: 609693 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
MSH5 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
MSH5 - mutS homolog 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MSH5-SAPCD1 - MSH5-SAPCD1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SAPCD1 - suppressor APC domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039651.1 | 3752 | Intron | NP_001034740.1 |
SAPCD1-AS1 - SAPCD1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VWA7 - von Willebrand factor A domain containing 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_025258.2 | 3752 | Intron | NP_079534.2 | |||
XM_005249427.2 | 3752 | UTR 3 | XP_005249484.1 | |||
XM_017011327.1 | 3752 | UTR 3 | XP_016866816.1 | |||
XM_017011328.1 | 3752 | UTR 3 | XP_016866817.1 | |||
XM_017011329.1 | 3752 | UTR 3 | XP_016866818.1 |