Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCATTTTACAGAAGAAACAGGAC[A/C]AGAGAGGGAAGGTGACCTGAAAGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603477 MIM: 607075 MIM: 614774 | ||||||||||||||||||||
Literature Links: |
ATP5J2-PTCD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP5J2-PTCD1 - ATP5J2-PTCD1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BUD31 - BUD31 homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003910.3 | 303 | UTR 5 | NP_003901.2 | |||
XM_005250670.4 | 303 | UTR 5 | XP_005250727.1 | |||
XM_005250671.4 | 303 | UTR 5 | XP_005250728.1 | |||
XM_005250674.3 | 303 | UTR 5 | XP_005250731.1 | |||
XM_017012760.1 | 303 | UTR 5 | XP_016868249.1 | |||
XM_017012761.1 | 303 | UTR 5 | XP_016868250.1 | |||
XM_017012762.1 | 303 | UTR 5 | XP_016868251.1 |
PDAP1 - PDGFA associated protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTCD1 - pentatricopeptide repeat domain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |