Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTCCTGTCTTGGCCTTCCAAAGTG[C/T]TAGGATCATAGATTTGAGCTCCTAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603052 MIM: 614774 | ||||||||||||||||||||
Literature Links: |
ATP5J2-PTCD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP5J2-PTCD1 - ATP5J2-PTCD1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198879.1 | Intron | NP_001185808.1 |
CPSF4 - cleavage and polyadenylation specific factor 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001081559.2 | Intron | NP_001075028.1 | ||||
NM_001318160.1 | Intron | NP_001305089.1 | ||||
NM_001318161.1 | Intron | NP_001305090.1 | ||||
NM_001318162.1 | Intron | NP_001305091.1 | ||||
NM_006693.3 | Intron | NP_006684.1 | ||||
XM_011515755.2 | Intron | XP_011514057.1 | ||||
XM_011515756.2 | Intron | XP_011514058.1 | ||||
XM_011515757.2 | Intron | XP_011514059.1 | ||||
XM_017011700.1 | Intron | XP_016867189.1 | ||||
XM_017011701.1 | Intron | XP_016867190.1 | ||||
XM_017011702.1 | Intron | XP_016867191.1 | ||||
XM_017011703.1 | Intron | XP_016867192.1 |
PTCD1 - pentatricopeptide repeat domain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |