Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGTGCTGGGAAAAAATCAGCTCTC[G/T]GAAGAAATGCCTTGATCCATAGTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603258 | ||||||||||||||||||||
Literature Links: |
IKBKB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IKBKB - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001190720.2 | Intron | NP_001177649.1 | ||||
NM_001242778.1 | Intron | NP_001229707.1 | ||||
NM_001556.2 | Intron | NP_001547.1 | ||||
XM_005273490.2 | Intron | XP_005273547.1 | ||||
XM_005273491.4 | Intron | XP_005273548.1 | ||||
XM_005273492.3 | Intron | XP_005273549.1 | ||||
XM_005273493.3 | Intron | XP_005273550.1 | ||||
XM_005273494.2 | Intron | XP_005273551.1 | ||||
XM_005273495.2 | Intron | XP_005273552.1 | ||||
XM_005273496.3 | Intron | XP_005273553.1 | ||||
XM_005273498.3 | Intron | XP_005273555.1 | ||||
XM_011544517.2 | Intron | XP_011542819.1 | ||||
XM_011544518.2 | Intron | XP_011542820.1 | ||||
XM_011544519.2 | Intron | XP_011542821.1 | ||||
XM_011544520.2 | Intron | XP_011542822.1 | ||||
XM_011544521.2 | Intron | XP_011542823.1 | ||||
XM_011544522.2 | Intron | XP_011542824.1 | ||||
XM_017013396.1 | Intron | XP_016868885.1 |
LOC101929897 - uncharacterized LOC101929897 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |