Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGTCCCTAGGGACAGCCATCCGGG[A/G]CCGCACGCGCAGGTCCTCGAGGATA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 107941 MIM: 609455 | ||||||||||||||||||||
Literature Links: |
ARRB2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARRB2 - arrestin beta 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001257328.1 | 124 | Intron | NP_001244257.1 | |||
NM_001257329.1 | 124 | Intron | NP_001244258.1 | |||
NM_001257330.1 | 124 | Intron | NP_001244259.1 | |||
NM_001257331.1 | 124 | Intron | NP_001244260.1 | |||
NM_004313.3 | 124 | Intron | NP_004304.1 | |||
NM_199004.1 | 124 | Intron | NP_945355.1 | |||
XM_006721520.1 | 124 | Intron | XP_006721583.1 | |||
XM_011523858.2 | 124 | Missense Mutation | GAC,GGC | D,G 35 | XP_011522160.1 | |
XM_017024645.1 | 124 | Intron | XP_016880134.1 |
LOC101559451 - uncharacterized LOC101559451 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PELP1 - proline, glutamate and leucine rich protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |