Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAATTTGAAAATTATGAAACTTCCC[A/C]GTGTTTTTTTGTGAGAGACATCTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611425 MIM: 604111 MIM: 610969 | ||||||||||||||||||||
Literature Links: |
CNTROB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CNTROB - centrobin, centriole duplication and spindle assembly protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001037144.5 | Intron | NP_001032221.1 | ||||
NM_053051.3 | Intron | NP_444279.2 | ||||
XM_005256437.2 | Intron | XP_005256494.1 | ||||
XM_005256438.2 | Intron | XP_005256495.1 | ||||
XM_005256439.2 | Intron | XP_005256496.1 | ||||
XM_017024128.1 | Intron | XP_016879617.1 | ||||
XM_017024129.1 | Intron | XP_016879618.1 | ||||
XM_017024130.1 | Intron | XP_016879619.1 | ||||
XM_017024131.1 | Intron | XP_016879620.1 | ||||
XM_017024132.1 | Intron | XP_016879621.1 | ||||
XM_017024133.1 | Intron | XP_016879622.1 | ||||
XM_017024134.1 | Intron | XP_016879623.1 | ||||
XM_017024135.1 | Intron | XP_016879624.1 | ||||
XM_017024136.1 | Intron | XP_016879625.1 | ||||
XM_017024137.1 | Intron | XP_016879626.1 | ||||
XM_017024138.1 | Intron | XP_016879627.1 | ||||
XM_017024139.1 | Intron | XP_016879628.1 | ||||
XM_017024140.1 | Intron | XP_016879629.1 | ||||
XM_017024141.1 | Intron | XP_016879630.1 | ||||
XM_017024142.1 | Intron | XP_016879631.1 | ||||
XM_017024143.1 | Intron | XP_016879632.1 | ||||
XM_017024144.1 | Intron | XP_016879633.1 |
KCNAB3 - potassium voltage-gated channel subfamily A regulatory beta subunit 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRAPPC1 - trafficking protein particle complex 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |