Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTACCAGCACTAATCTGGCCTCTA[C/T]CACATTTTTGGATGAGGGCATGAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 102582 MIM: 601511 | ||||||||||||||||||||
Literature Links: |
STAT3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
STAT3 - signal transducer and activator of transcription 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003150.3 | Intron | NP_003141.2 | ||||
NM_139276.2 | Intron | NP_644805.1 | ||||
NM_213662.1 | Intron | NP_998827.1 | ||||
XM_005257616.3 | Intron | XP_005257673.2 | ||||
XM_005257617.3 | Intron | XP_005257674.2 | ||||
XM_011525145.2 | Intron | XP_011523447.1 | ||||
XM_011525146.2 | Intron | XP_011523448.1 | ||||
XM_017024972.1 | Intron | XP_016880461.1 | ||||
XM_017024973.1 | Intron | XP_016880462.1 | ||||
XM_017024974.1 | Intron | XP_016880463.1 | ||||
XM_017024975.1 | Intron | XP_016880464.1 | ||||
XM_017024976.1 | Intron | XP_016880465.1 |
STAT5A - signal transducer and activator of transcription 5A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |