Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCCCCCGTCTCCCCGCTCGGCCC[A/G]GCTCCGGCGGGAGGAGTGAGGACGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 151750 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LIPE PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
LIPE - lipase E, hormone sensitive type | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005357.3 | 2313 | Silent Mutation | GCC,GCT | A,A 1057 | NP_005348.2 | |
XM_005258937.3 | 2313 | Silent Mutation | GCC,GCT | A,A 981 | XP_005258994.1 | |
XM_005258938.4 | 2313 | Silent Mutation | GCC,GCT | A,A 802 | XP_005258995.1 | |
XM_005258939.3 | 2313 | Silent Mutation | GCC,GCT | A,A 819 | XP_005258996.2 | |
XM_005258940.3 | 2313 | Silent Mutation | GCC,GCT | A,A 756 | XP_005258997.1 | |
XM_006723218.2 | 2313 | Silent Mutation | GCC,GCT | A,A 756 | XP_006723281.1 | |
XM_017026810.1 | 2313 | Silent Mutation | GCC,GCT | A,A 756 | XP_016882299.1 |
LIPE-AS1 - LIPE antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101930071 - uncharacterized LOC101930071 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |