Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATGAAGGAGCAGTAGACAGCGACC[A/C]AAGCACACCACTTCAGCTAGGGAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600944 MIM: 609458 MIM: 616850 | ||||||||||||||||||||
Literature Links: |
DHPS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DHPS - deoxyhypusine synthase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAN2B1 - mannosidase alpha class 2B member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR83 - WD repeat domain 83 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099737.2 | 283 | UTR 5 | NP_001093207.1 | |||
NM_032332.3 | 283 | Intron | NP_115708.1 |
WDR83OS - WD repeat domain 83 opposite strand | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016145.3 | 283 | Missense Mutation | TGG,TTG | W,L 58 | NP_057229.1 | |
XM_017026864.1 | 283 | Missense Mutation | TGG,TTG | W,L 58 | XP_016882353.1 |