Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATAGGTGGGTGGCAGCAGAGAAGG[G/T]GCTCCAGCAGCCACCACCTCCCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601273 MIM: 190315 | ||||||||||||||||||||
Literature Links: |
CLTCL1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CLTCL1 - clathrin heavy chain like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001835.3 | Intron | NP_001826.3 | ||||
NM_007098.3 | Intron | NP_009029.3 | ||||
XM_011530401.2 | Intron | XP_011528703.1 | ||||
XM_017028953.1 | Intron | XP_016884442.1 | ||||
XM_017028954.1 | Intron | XP_016884443.1 | ||||
XM_017028955.1 | Intron | XP_016884444.1 | ||||
XM_017028956.1 | Intron | XP_016884445.1 | ||||
XM_017028957.1 | Intron | XP_016884446.1 |
LINC01311 - long intergenic non-protein coding RNA 1311 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC25A1 - solute carrier family 25 member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |