Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCTGGAGATTTGGACTTCATGGGG[A/G]GGGAGTGTGGGAGTGGAAGGTGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607477 MIM: 610230 | ||||||||||||||||||||
Literature Links: |
GTSE1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GTSE1 - G2 and S-phase expressed 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRMU - tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001282782.1 | Intron | NP_001269711.1 | ||||
NM_001282783.1 | Intron | NP_001269712.1 | ||||
NM_001282784.1 | Intron | NP_001269713.1 | ||||
NM_001282785.1 | Intron | NP_001269714.1 | ||||
NM_018006.4 | Intron | NP_060476.2 | ||||
XM_005261678.1 | Intron | XP_005261735.1 | ||||
XM_005261681.1 | Intron | XP_005261738.1 | ||||
XM_011530271.2 | Intron | XP_011528573.1 | ||||
XM_011530272.1 | Intron | XP_011528574.1 | ||||
XM_011530273.1 | Intron | XP_011528575.1 | ||||
XM_011530274.2 | Intron | XP_011528576.1 | ||||
XM_011530275.1 | Intron | XP_011528577.1 |