Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGCAACCCAGAAGTCGATGTCGGA[G/T]TACCACACCCCCTTCTAACAAATTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
RAP2C PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
RAP2C - RAP2C, member of RAS oncogene family | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271186.1 | Intron | NP_001258115.1 | ||||
NM_001271187.1 | Intron | NP_001258116.1 | ||||
NM_021183.4 | Intron | NP_067006.3 | ||||
XM_006724775.2 | Intron | XP_006724838.1 | ||||
XM_011531376.1 | Intron | XP_011529678.1 |
RAP2C-AS1 - RAP2C antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |