Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGTTGAGAGGAAGGAAACTAGGG[G/T]GGGTTTTGTTAGATGCTTCCATGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 176265 | ||||||||||||||||||||
Literature Links: |
KCNC4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KCNC4 - potassium voltage-gated channel subfamily C member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039574.2 | Intron | NP_001034663.1 | ||||
NM_004978.4 | Intron | NP_004969.2 | ||||
XM_006710625.3 | Intron | XP_006710688.1 | ||||
XM_006710627.3 | Intron | XP_006710690.1 | ||||
XM_011541401.2 | Intron | XP_011539703.1 | ||||
XM_011541402.1 | Intron | XP_011539704.1 | ||||
XM_011541403.1 | Intron | XP_011539705.1 | ||||
XM_011541404.1 | Intron | XP_011539706.1 |
KCNC4-AS1 - KCNC4 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |