Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCTTACATTTGACACAACTACTAT[C/T]TGAAATGGACAAGAAGATGAGATCT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 611035 | |||||||||||||||||||||||
Literature Links: |
APLF PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
APLF - aprataxin and PNKP like factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FBXO48 - F-box protein 48 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024680.2 | Intron | NP_001019851.1 | ||||
XM_005264407.2 | Intron | XP_005264464.1 | ||||
XM_017004437.1 | Intron | XP_016859926.1 |