Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCCCTCTCCTGCCTCACCTTCCAT[A/C]TCTCCGAACACTTCTTGGAGAATTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605005 MIM: 163906 | ||||||||||||||||||||
Literature Links: |
GALNT7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GALNT7 - polypeptide N-acetylgalactosaminyltransferase 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HMGB2 - high mobility group box 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130688.1 | 276 | Missense Mutation | AGA,ATA | R,I 48 | NP_001124160.1 | |
NM_001130689.1 | 276 | Missense Mutation | AGA,ATA | R,I 48 | NP_001124161.1 | |
NM_002129.3 | 276 | Missense Mutation | AGA,ATA | R,I 48 | NP_002120.1 |
LOC105377538 - uncharacterized LOC105377538 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |