Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTAAATTTTATTTTTTATTTATTG[A/T]TACTATCTTACTGTATCCACAAATA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608519 MIM: 606143 | ||||||||||||||||||||
Literature Links: |
FBXO16 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FBXO16 - F-box protein 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FZD3 - frizzled class receptor 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017412.3 | Intron | NP_059108.1 | ||||
NM_145866.1 | Intron | NP_665873.1 | ||||
XM_017013841.1 | Intron | XP_016869330.1 | ||||
XM_017013842.1 | Intron | XP_016869331.1 | ||||
XM_017013843.1 | Intron | XP_016869332.1 | ||||
XM_017013844.1 | Intron | XP_016869333.1 |
MIR4288 - microRNA 4288 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |