Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCCTGCACCTCCCATGTTGGTGA[C/T]GTTCCAGTGTTGCATTCTGCTACAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605436 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
SNORD116-1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
SNORD116-1 - small nucleolar RNA, C/D box 116-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-2 - small nucleolar RNA, C/D box 116-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-3 - small nucleolar RNA, C/D box 116-3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-4 - small nucleolar RNA, C/D box 116-4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-5 - small nucleolar RNA, C/D box 116-5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-6 - small nucleolar RNA, C/D box 116-6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116@ - small nucleolar RNA, C/D box 116 cluster | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |