Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATCACTGGAGGCCAGGAGTTGGAG[A/C]CCAGCCTGGATGACAGAGGGAGATC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615229 MIM: 603872 | ||||||||||||||||||||
Literature Links: |
C1QL4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C1QL4 - complement C1q like 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927267 - uncharacterized LOC101927267 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TROAP - trophinin associated protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001100620.1 | 718 | UTR 3 | NP_001094090.1 | |||
NM_001278324.1 | 718 | UTR 3 | NP_001265253.1 | |||
NM_005480.3 | 718 | Intron | NP_005471.3 | |||
XM_006719181.1 | 718 | Intron | XP_006719244.1 | |||
XM_011537723.1 | 718 | Intron | XP_011536025.1 | |||
XM_011537724.1 | 718 | Intron | XP_011536026.1 | |||
XM_011537725.2 | 718 | UTR 3 | XP_011536027.1 |