Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCCTGCAGGTGAGAAGATGACAGA[A/G]GAAGAAGTAGAGATGCTGGTGGCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609931 MIM: 609930 MIM: 601734 | ||||||||||||||||||||
Literature Links: |
LOC107987175 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC107987175 - uncharacterized LOC107987175 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYL6 - myosin light chain 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021019.4 | 507 | Silent Mutation | GAA,GAG | E,E 122 | NP_066299.2 | |
NM_079423.3 | 507 | Silent Mutation | GAA,GAG | E,E 122 | NP_524147.2 |
MYL6B - myosin light chain 6B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMARCC2 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |