Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTCCTTGTCTAAGAGGTAGCAGCA[A/G]CAACAGCGCCCACCTTCTGGGCAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 603407 | ||||||||||||||||||||
Literature Links: |
LOC101929516 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC101929516 - uncharacterized LOC101929516 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PABPC4 - poly(A) binding protein cytoplasmic 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001135653.1 | Intron | NP_001129125.1 | ||||
NM_001135654.1 | Intron | NP_001129126.1 | ||||
NM_003819.3 | Intron | NP_003810.1 |
PPIEL - peptidylprolyl isomerase E like pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA55 - small nucleolar RNA, H/ACA box 55 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |