Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACAGGGGGGCTTCGCCCGCTGCTA[C/T]GAGGCCACTGACACAGAGACTGGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 607336 MIM: 602913 MIM: 611713 | ||||||||||||||||||||
Literature Links: |
BEST4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BEST4 - bestrophin 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BTBD19 - BTB domain containing 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLK3 - polo like kinase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004073.3 | 470 | Silent Mutation | TAC,TAT | Y,Y 77 | NP_004064.2 |
TCTEX1D4 - Tctex1 domain containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |