Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACTACTACTGGTAGCGCAAAAAAT[C/T]ACGATGTTGAATTTGTGTTGGGCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600454 MIM: 600455 | ||||||||||||||||||||
Literature Links: |
RPS3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
RPS3 - ribosomal protein S3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001005.4 | Intron | NP_000996.2 | ||||
NM_001256802.1 | Intron | NP_001243731.1 | ||||
NM_001260506.1 | Intron | NP_001247435.1 | ||||
NM_001260507.1 | Intron | NP_001247436.1 |
SNORD15A - small nucleolar RNA, C/D box 15A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD15B - small nucleolar RNA, C/D box 15B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |