Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGCCTGTGGATCAGCCACTCCCAC[A/G]GCCGCCCCCAGTGTCCACAGAGCCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602063 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC171391 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LOC171391 - uncharacterized LOC171391 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDDC1 - Parkinson disease 7 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318818.1 | 829 | Intron | NP_001305747.1 | |||
NM_001318820.1 | 829 | Intron | NP_001305749.1 | |||
NM_001318821.1 | 829 | Intron | NP_001305750.1 | |||
NM_001318822.1 | 829 | Intron | NP_001305751.1 | |||
NM_001318823.1 | 829 | Intron | NP_001305752.1 | |||
NM_001318824.1 | 829 | Intron | NP_001305753.1 | |||
NM_182612.3 | 829 | Intron | NP_872418.1 | |||
XM_005252898.2 | 829 | Intron | XP_005252955.1 | |||
XM_011520064.1 | 829 | Intron | XP_011518366.1 | |||
XM_017017660.1 | 829 | Intron | XP_016873149.1 | |||
XM_017017661.1 | 829 | Intron | XP_016873150.1 | |||
XM_017017662.1 | 829 | UTR 3 | XP_016873151.1 | |||
XM_017017663.1 | 829 | Intron | XP_016873152.1 | |||
XM_017017664.1 | 829 | Intron | XP_016873153.1 | |||
XM_017017665.1 | 829 | Intron | XP_016873154.1 | |||
XM_017017666.1 | 829 | Intron | XP_016873155.1 | |||
XM_017017667.1 | 829 | Intron | XP_016873156.1 | |||
XM_017017668.1 | 829 | Intron | XP_016873157.1 |
TALDO1 - transaldolase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |